Specifications

Product Data
Gene ID	1593
Forward Sequence	GTGCTGCCTTTCTGGAAGCGAT
Reverse Sequence	TAGCCAGACACCTGGATGCCAT
Accession No	NM_000784, NM_000784.1, NM_000784.2, NM_000784.3, BC017044, BC040430, BC051851, NM_000784.4
UniProt ID	Q02318
Synonyms	CP27; CTX; CYP27
Component	1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
Quality Control	The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage	Store at -20°C.
Stability	The primer mix is stable for one year from date of shipping.