SARS-CoV-2 (COVID-19) qPCR Primer Pair S protein

Référence HP234776

Conditionnement : 200reactions

Demander plus d'informations

Contactez votre distributeur local :


Téléphone :

SARS-CoV-2 (COVID-19) qPCR Primer Pair S protein

Specifications
Product Data
Locus ID 43740568
Forward Sequence caactgaaatctatcaggccg
Reverse Sequence accaacaccattagtgggttg
Components 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage Store at -20°C.
Stability The primer mix is stable for one year from date of shipping.
Write Your Own Review
You're reviewing:SARS-CoV-2 (COVID-19) qPCR Primer Pair S protein
Your Rating
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Products

  • cDNA Clones
  • Antibodies
  • Proteins
  • Vectors
  • RNAi
  • Gene Expression
  • Assay Kits
  • Tissues
  • Others

Product Support

  • Product FAQs
  • Product Manuals
  • SDS
  • Citations

Customer Support

  • Order Support
  • Technical Support
  • International Distributors
  • cDNA Clone Match
  • Product Review

Learning Resources

  • Video and Webinar
  • Brochures & Flyers
  • Protocols
  • Ebooks
  • Scientific Papers
  • Bioinformatics Tools

About Us

  • About Us
  • Press Releases
  • Conferences
  • Customer Testimonials
  • Careers
  • Legal Notices
  • Contact Us