Glycogenin 1 (GYG1) (NM_001184720) Human Untagged Clone

CAT#: SC328539

GYG1 (untagged)-Human glycogenin 1 (GYG1) transcript variant 2


Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GYG1
Synonyms GSD15; GYG
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC328539 representing NM_001184720.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACAGATCAGGCCTTTGTGACACTAACCACAAACGATGCCTACGCCAAAGGTGCCCTGGTCCTGGGA
TCATCTCTGAAACAGCACAGGACCACCAGGAGGCTGGTCGTGCTCGCCACCCCTCAGGTCTCAGACTCC
ATGAGAAAAGTTTTAGAGACAGTCTTTGATGAAGTCATCATGGTAGATGTCTTGGACAGTGGCGATTCT
GCTCATCTAACCTTAATGAAGAGGCCAGAGTTGGGTGTCACGCTGACAAAGCTCCACTGCTGGTCGCTT
ACACAGTATTCAAAATGTGTATTCATGGATGCAGATACTCTGGTCCTAGCAAATATTGATGATCTTTTT
GACAGAGAAGAATTGTCAGCAGCACCAGACCCAGGGTGGCCTGACTGCTTCAATTCCGGAGTCTTCGTT
TATCAGCCTTCAGTTGAAACATACAATCAGCTGTTGCATCTTGCTTCTGAGCAAGGTAGTTTTGATGGT
GGGGACCAAGGCATACTGAACACATTTTTTAGCAGCTGGGCAACAACAGATATCAGAAAACACCTGCCG
TTTATTTATAACCTAAGCAGCATCTCTATATACTCCTACCTCCCGGCATTTAAAGTGTTTGGTGCAAGT
GCCAAAGTTGTGCATTTCCTGGGACGAGTCAAACCATGGAATTATACTTATGATCCCAAAACAAAAAGT
GTCAAAAGTGAGGCCCATGATCCCAACATGACTCATCCAGAGTTTCTCATCCTGTGGTGGAACATCTTT
ACCACCAACGTTTTACCTCTGCTTCAACAATTTGGCCTTGTCAAAGACACCTGCTCATATGTAAATGTG
GAAGATGTCTCAGGAGCCATATCACATCTGTCCCTTGGGGAGATCCCAGCTATGGCACAGCCGTTTGTA
TCCTCGGAAGAACGGAAGGAACGATGGGAACAGGGCCAGGCTGATTATATGGGAGCAGATTCCTTTGAC
AACATCAAGAGGAAACTTGACACTTACCTCCAGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001184720
Insert Size 1002 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001184720.1
RefSeq Size 2000 bp
RefSeq ORF 1002 bp
Locus ID 2992
UniProt ID P46976
Cytogenetics 3q24
MW 37.5 kDa
Gene Summary This gene encodes a member of the glycogenin family. Glycogenin is a glycosyltransferase that catalyzes the formation of a short glucose polymer from uridine diphosphate glucose in an autoglucosylation reaction. This reaction is followed by elongation and branching of the polymer, catalyzed by glycogen synthase and branching enzyme, to form glycogen. This gene is expressed in muscle and other tissues. Mutations in this gene result in glycogen storage disease XV. This gene has pseudogenes on chromosomes 1, 8 and 13 respectively. Alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Sep 2010]
Transcript Variant: This variant (2) lacks an in-frame exon in the 3' CDS, as compared to variant 1. The resulting isoform (2) lacks an internal segment in the C-terminal region, as compared to isoform 1.

Other Versions