SARS-CoV-2 (COVID-19) qPCR Primer Pair N protein
Katalog-Nummer HP234775
Size : 200reactions
Contact local distributor :
SARS-CoV-2 (COVID-19) qPCR Primer Pair N protein
SKU
HP234775
qSTAR qPCR primer pairs against SARS-CoV-2 (COVID-19) Nucleocapsid Phosphoprotein (N protein) gene
5 Days*
| Product Data | |
| Locus ID | 43740575 |
|---|---|
| Forward Sequence | aagctggacttccctatggtg |
| Reverse Sequence | cgattgcagcattgttagcagg |
| Components | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM. |
| Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
| Storage | Store at -20°C. |
| Stability | The primer mix is stable for one year from date of shipping. |
Write Your Own Review
| Product Manuals |
| FAQs |
|
Related Products
Check items to add to the cart or
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.