Human CD26 (DPP4) activation kit by CRISPRa
CAT#: GA101256
DPP4 CRISPRa kit - CRISPR gene activation of human dipeptidyl peptidase 4
Find the corresponding CRISPRi Inhibitor Kit
Specifications
Product Data | |
Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
Symbol | DPP4 |
Locus ID | 1803 |
Kit Components | GA101256G1, CD26 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGACGTCATTTTTAGCTAAG GA101256G2, CD26 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGCCGTGGGGGAGGGGAAA GA101256G3, CD26 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AACCTCACGTGGACAGGCGA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc. |
Reference Data | |
RefSeq | NM_001935 |
UniProt ID | P27487 |
Synonyms | ADABP; ADCP2; CD26; DPPIV; TP103 |
Summary | The DPP4 gene encodes dipeptidyl peptidase 4, which is identical to adenosine deaminase complexing protein-2, and to the T-cell activation antigen CD26. It is an intrinsic type II transmembrane glycoprotein and a serine exopeptidase that cleaves X-proline dipeptides from the N-terminus of polypeptides. Dipeptidyl peptidase 4 is highly involved in glucose and insulin metabolism, as well as in immune regulation. This protein was shown to be a functional receptor for Middle East respiratory syndrome coronavirus (MERS-CoV), and protein modeling suggests that it may play a similar role with SARS-CoV-2, the virus responsible for COVID-19. [provided by RefSeq, Apr 2020] |
Documents
Product Manuals |
FAQs |
|
SDS |
Resources
Other Versions
SKU | Description | Size | |
---|---|---|---|
KN209466 | DPP4 - human gene knockout kit via CRISPR, HDR mediated | 1 657,00 EUR | |
KN209466BN | DPP4 - human gene knockout kit via CRISPR, HDR mediated | 1 657,00 EUR | |
KN209466LP | DPP4 - human gene knockout kit via CRISPR, HDR mediated | 1 657,00 EUR | |
KN209466RB | DPP4 - human gene knockout kit via CRISPR, HDR mediated | 1 657,00 EUR | |
KN409466 | DPP4 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. | 1 657,00 EUR |