ENGASE Human qPCR Primer Pair (NM_001042573)

CAT#: HP203673

qSTAR qPCR primer pairs against Homo sapiens gene ENGASE



SensiMix SYBR Master Mix

Product Images

Specifications

Product Data
Gene ID 64772
Forward Sequence TGGAGCTGATCCGAAAGCATGG
Reverse Sequence TGTGGGCAGATAACGCTCCAGT
Accession No NM_001042573, NM_001042573.1, NM_001042573.2, BC024213, BC042158, BC156537, NM_001042573.3
UniProt ID Q8NFI3
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage Store at -20°C.
Stability The primer mix is stable for one year from date of shipping.

Documents