Human alpha 1 Antitrypsin (SERPINA1) activation kit by CRISPRa

Cat# GA103534

Size : 1kit

Request more information

Contact local distributor :


Phone :

Human alpha 1 Antitrypsin (SERPINA1) activation kit by CRISPRa

Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol SERPINA1
Locus ID 5265
Components

GA103534G1, alpha 1 Antitrypsin gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTTCCTGGGTGGGCAGGAAC

GA103534G2, alpha 1 Antitrypsin gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTGGAGGCAGTGCATGCCCT

GA103534G3, alpha 1 Antitrypsin gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGACTTCGGGTGGAGGCAGT

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq NM_000295, NM_001002235, NM_001002236, NM_001127700, NM_001127701, NM_001127702, NM_001127703, NM_001127704, NM_001127705, NM_001127706, NM_001127707
UniProt ID P01009
Synonyms A1A; A1AT; AAT; alpha1AT; PI; PI1; PRO2275
Summary The protein encoded by this gene is a serine protease inhibitor belonging to the serpin superfamily whose targets include elastase, plasmin, thrombin, trypsin, chymotrypsin, and plasminogen activator. This protein is produced in the liver, the bone marrow, by lymphocytic and monocytic cells in lymphoid tissue, and by the Paneth cells of the gut. Defects in this gene are associated with chronic obstructive pulmonary disease, emphysema, and chronic liver disease. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2020]
Write Your Own Review
You're reviewing:Human alpha 1 Antitrypsin (SERPINA1) activation kit by CRISPRa
Your Rating
SKU Description Size
KN202082 SERPINA1 - human gene knockout kit via CRISPR, HDR mediated 1 kit
KN202082BN SERPINA1 - human gene knockout kit via CRISPR, HDR mediated 1 kit
KN202082LP SERPINA1 - human gene knockout kit via CRISPR, HDR mediated 1 kit
KN202082RB SERPINA1 - human gene knockout kit via CRISPR, HDR mediated 1 kit
KN402082 SERPINA1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Products

  • cDNA Clones
  • Antibodies
  • Proteins
  • Vectors
  • RNAi
  • Gene Expression
  • Assay Kits
  • Tissues
  • Others

Product Support

  • Product FAQs
  • Product Manuals
  • SDS
  • Citations

Customer Support

  • Order Support
  • Technical Support
  • International Distributors
  • cDNA Clone Match
  • Product Review

Learning Resources

  • Video and Webinar
  • Brochures & Flyers
  • Protocols
  • Ebooks
  • Scientific Papers
  • Bioinformatics Tools

About Us

  • About Us
  • Press Releases
  • Conferences
  • Customer Testimonials
  • Careers
  • Legal Notices
  • Contact Us