Human alpha 1 Antitrypsin (SERPINA1) activation kit by CRISPRa
Cat# GA103534
Size : 1kit
Contact local distributor :
Human alpha 1 Antitrypsin (SERPINA1) activation kit by CRISPRa
SKU
GA103534
SERPINA1 CRISPRa kit - CRISPR gene activation of human serpin family A member 1
2 Weeks*
| Product Data | |
| Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
|---|---|
| Target Symbol | SERPINA1 |
| Locus ID | 5265 |
| Components | GA103534G1, alpha 1 Antitrypsin gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTTCCTGGGTGGGCAGGAAC GA103534G2, alpha 1 Antitrypsin gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTGGAGGCAGTGCATGCCCT GA103534G3, alpha 1 Antitrypsin gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGACTTCGGGTGGAGGCAGT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
| Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc. |
| Reference Data | |
| RefSeq | NM_000295, NM_001002235, NM_001002236, NM_001127700, NM_001127701, NM_001127702, NM_001127703, NM_001127704, NM_001127705, NM_001127706, NM_001127707 |
| UniProt ID | P01009 |
| Synonyms | A1A; A1AT; AAT; alpha1AT; PI; PI1; PRO2275 |
| Summary | The protein encoded by this gene is a serine protease inhibitor belonging to the serpin superfamily whose targets include elastase, plasmin, thrombin, trypsin, chymotrypsin, and plasminogen activator. This protein is produced in the liver, the bone marrow, by lymphocytic and monocytic cells in lymphoid tissue, and by the Paneth cells of the gut. Defects in this gene are associated with chronic obstructive pulmonary disease, emphysema, and chronic liver disease. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2020] |
Write Your Own Review
| Product Manuals |
| FAQs |
|
| SDS |
| SKU | Description | Size | ||
|---|---|---|---|---|
| KN202082 | SERPINA1 - human gene knockout kit via CRISPR, HDR mediated | 1 kit | | |
| KN202082BN | SERPINA1 - human gene knockout kit via CRISPR, HDR mediated | 1 kit | | |
| KN202082LP | SERPINA1 - human gene knockout kit via CRISPR, HDR mediated | 1 kit | | |
| KN202082RB | SERPINA1 - human gene knockout kit via CRISPR, HDR mediated | 1 kit | | |
| KN402082 | SERPINA1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. | 1 kit | | |
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.