Biorbyt

 

Biorbyt is a UK-based supplier specializing in life science reagents. They offer a wide range of products, including antibodies, ELISA kits, small molecules, and proteins. Researchers can choose from thousands of research antibodies and reagents for various applications. Biorbyt collaborates with top scientists and scholars to develop high-quality products, covering areas such as immunology, cell biology, molecular biology, and proteinomics. Their comprehensive offerings include immune assays, protein mass spectrometry, cell culture, custom antibody services, animal model establishment, and biochemical reagents. 

Biorbyt provides valuable reagents and services for biological research. With a wide selection of antibodies, assay kits, small molecules, and proteins, Biorbyt supports scientists in their experiments. They have established stable partnerships with renowned universities, research institutes, pharmaceutical companies, biotech firms, and hospitals worldwide. Biorbyt’s commitment to high-quality products and professional technical services spans immunology, cell biology, molecular biology, proteinomics, and more.

 

Learn more :

 

 

 

 

         

Antibodies - Chicken Ig Why ?

 

 

   

Cancer Pathways

Apoptosis Signaling

 

 

Fix & Perm Cell Fixation

and Permeabilization

 

 

   

         

Immunology Pathways

 

 

Products for advancing

discoveries

 

Working in larger model

animal species

 
 

Watch the videos: 

     

 

       
         

Recombinant Antibodies

 

 

 

 

Cancer Biomarkers

 

 
 
 
Adapters for the preparation of ARN (cDNA) libraries for Illumina NGS

Adapters for the preparation of ARN (cDNA) libraries for Illumina NGS


Sequencing random fragments of DNA is possible via the addition of short nucleotide sequences which allow any DNA fragment to:
1. Bind to a flow cell for next generation sequencing
2. Allow for PCR enrichment of adapter ligated DNA fragments only
3. Allow for indexing or 'barcoding' of samples so multiple DNA libraries can be mixed together into 1 sequencing lane (known as multiplexing)

During library preparation each DNA fragment gets and addional A overhang added to both ends.

The sequencing adapters are the following:
# TruSeq Universal Adapter:
5 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T 3
# TruSeq Indexed Adapter
5 P*GATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG 3

The stars indicate a phosphorothioate bond between the last C and T to prevent cleaving off the last T that is needed for annealing the overhang. The phosphate group on the indexed adapter is required to ligate the adapter to the DNA fragment.
The NNNNNN in the indexed adapter above represents the barcode. Reverse the indexed adapter and note how the last 12 bases are complementary.

Diagram of an adapter




P5 and P7 : Flow cell attachment sites
ID : Index
Adapter : Sequencing primer binding sites
DNA fragment : Insert

Search result : 4 product found

Refine your search :

RUOCE / IVD
  • kit 4
APPLY FILTERS
REINITIALIZE


Cat#
Description
Cond.
Price Bef. VAT