Human CD26 (DPP4) activation kit by CRISPRa

Cat# GA101256

Size : 1kit

Request more information

Contact local distributor :


Phone :

Human CD26 (DPP4) activation kit by CRISPRa

SKU
GA101256
DPP4 CRISPRa kit - CRISPR gene activation of human dipeptidyl peptidase 4
2 Weeks*
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol DPP4
Locus ID 1803
Components

GA101256G1, CD26 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGACGTCATTTTTAGCTAAG

GA101256G2, CD26 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGCCGTGGGGGAGGGGAAA

GA101256G3, CD26 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AACCTCACGTGGACAGGCGA

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077

OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_001935
UniProt ID P27487
Synonyms ADABP; ADCP2; CD26; DPPIV; TP103
Summary The DPP4 gene encodes dipeptidyl peptidase 4, which is identical to adenosine deaminase complexing protein-2, and to the T-cell activation antigen CD26. It is an intrinsic type II transmembrane glycoprotein and a serine exopeptidase that cleaves X-proline dipeptides from the N-terminus of polypeptides. Dipeptidyl peptidase 4 is highly involved in glucose and insulin metabolism, as well as in immune regulation. This protein was shown to be a functional receptor for Middle East respiratory syndrome coronavirus (MERS-CoV), and protein modeling suggests that it may play a similar role with SARS-CoV-2, the virus responsible for COVID-19. [provided by RefSeq, Apr 2020]
SKU Description Size
KN209466 DPP4 - human gene knockout kit via CRISPR, HDR mediated 1 kit
KN209466BN DPP4 - human gene knockout kit via CRISPR, HDR mediated 1 kit
KN209466LP DPP4 - human gene knockout kit via CRISPR, HDR mediated 1 kit
KN209466RB DPP4 - human gene knockout kit via CRISPR, HDR mediated 1 kit
KN409466 DPP4 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.