Biorbyt

Productos para avanzar en sus descubrimiento

 
Desde anticuerpos a proteínas, desde productos bioquímicos a kits ELISA, los productos de investigación de alta calidad de Biorbyt están a su disposición para hacer posible una investigación de primera clase y contribuir a una comprensión más profunda de las ciencias de la vida.
 
Un completo catálogo de productos de investigación en ciencias de la vida que cubre las áreas de Neurociencia, Transducción de señales, Biología celular, Metabolismo del cáncer, Cardiovascular y otras.
 
Gama de productos 
 
  • Anticuerpos
Elija entre más de 100.000 anticuerpos primarios y más de 2.000 secundarios. Monoclonales y policlonales probados en diversas aplicaciones: WB, ELISA, IHC, FACS y muchas más.
 
  • Proteínas
Elija entre más de 7.000 proteínas y más de 400 proteínas activas. Todas nuestras proteínas han sido validadas para su uso en ELISA, WB e IHC-P
 
  • Productos bioquímicos
Disponemos de más de 10.000 productos bioquímicos para utilizar en su investigación.
 
  • Kits ELISA
Disponemos de más de 2.000 kits ELISA que cubren muchas áreas de investigación. Cada kit incluye un protocolo detallado y ejemplos de los resultados esperados.
 
 
Adapters for the preparation of ARN (cDNA) libraries for Illumina NGS

Adapters for the preparation of ARN (cDNA) libraries for Illumina NGS


Sequencing random fragments of DNA is possible via the addition of short nucleotide sequences which allow any DNA fragment to:
1. Bind to a flow cell for next generation sequencing
2. Allow for PCR enrichment of adapter ligated DNA fragments only
3. Allow for indexing or 'barcoding' of samples so multiple DNA libraries can be mixed together into 1 sequencing lane (known as multiplexing)

During library preparation each DNA fragment gets and addional A overhang added to both ends.

The sequencing adapters are the following:
# TruSeq Universal Adapter:
5 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T 3
# TruSeq Indexed Adapter
5 P*GATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG 3

The stars indicate a phosphorothioate bond between the last C and T to prevent cleaving off the last T that is needed for annealing the overhang. The phosphate group on the indexed adapter is required to ligate the adapter to the DNA fragment.
The NNNNNN in the indexed adapter above represents the barcode. Reverse the indexed adapter and note how the last 12 bases are complementary.

Diagram of an adapter




P5 and P7 : Flow cell attachment sites
ID : Index
Adapter : Sequencing primer binding sites
DNA fragment : Insert

Resultados de su búsqueda : 4 Producto encontrado

Refine su búsqueda :

RUOCE / IVD
  • kit 4
APLICAR FILTROS
REINICIE


Referencia
Descripción
Cond.
Precio Sin IVA