Biorbyt
![]() |
||
Productos para avanzar en sus descubrimiento Desde anticuerpos a proteínas, desde productos bioquímicos a kits ELISA, los productos de investigación de alta calidad de Biorbyt están a su disposición para hacer posible una investigación de primera clase y contribuir a una comprensión más profunda de las ciencias de la vida.
Un completo catálogo de productos de investigación en ciencias de la vida que cubre las áreas de Neurociencia, Transducción de señales, Biología celular, Metabolismo del cáncer, Cardiovascular y otras.
Gama de productos
Elija entre más de 100.000 anticuerpos primarios y más de 2.000 secundarios. Monoclonales y policlonales probados en diversas aplicaciones: WB, ELISA, IHC, FACS y muchas más.
Elija entre más de 7.000 proteínas y más de 400 proteínas activas. Todas nuestras proteínas han sido validadas para su uso en ELISA, WB e IHC-P
Disponemos de más de 10.000 productos bioquímicos para utilizar en su investigación.
Disponemos de más de 2.000 kits ELISA que cubren muchas áreas de investigación. Cada kit incluye un protocolo detallado y ejemplos de los resultados esperados.
Página web: https://www.biorbyt.com/
|
![Adapters for the preparation of ARN (cDNA) libraries for Illumina NGS](https://www.clinisciences.com/es/upload/adn2-bzw63x.jpg)
Adapters for the preparation of ARN (cDNA) libraries for Illumina NGS
Sequencing random fragments of DNA is possible via the
addition of short nucleotide sequences which allow any DNA fragment to:
1. Bind to a flow cell
for next generation sequencing
2. Allow for PCR
enrichment of adapter ligated DNA fragments only
3. Allow for indexing
or 'barcoding' of samples so multiple DNA libraries can be mixed
together into 1 sequencing lane (known as multiplexing)
During library preparation each DNA fragment gets and
addional A overhang added to both ends.
The sequencing adapters are the following:
# TruSeq
Universal Adapter:
5
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T 3
# TruSeq
Indexed Adapter
5 P*GATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG
3
The stars indicate a phosphorothioate bond between the last
C and T to prevent cleaving off the last T that is needed for annealing
the overhang. The phosphate group on the indexed adapter is required to
ligate the adapter to the DNA fragment.
The NNNNNN in the indexed adapter above represents the
barcode. Reverse the indexed adapter and note how the last 12 bases are
complementary.
Diagram of an adapter
![](/upload/illuminaadapters-wkstxu-WC5ZGHDg.jpg)
P5 and P7 : Flow cell attachment sites
ID : Index
Adapter : Sequencing primer binding sites
DNA fragment : Insert
Resultados de su búsqueda : 4 Producto encontrado
Refine su búsqueda :
RUOCE / IVD
- kit 4
Referencia
Descripción
Cond.
Precio Sin IVA
‹
›