GC1q R (C1QBP) (NM_001212) Human 3' UTR Clone

CAT#: SC202835

3' UTR clone of complement component 1 q subcomponent binding protein (C1QBP) nuclear gene encoding mitochondrial protein for miRNA target validation

Datasheet
SDS

Product Images

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol C1QBP
Synonyms COXPD33; gC1Q-R; GC1QBP; gC1qR; HABP1; p32; SF2AP32; SF2p32
ACCN NM_001212
Insert Size 268 bp
Sequence Data
>SC202835 3’UTR clone of NM_001212
The sequence shown below is from the reference sequence of NM_001212. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GACCTCAAGAGTTTTGTCAAGAGCCAGTAGAGCAGACAGATGCTGAAAGCCATAGTTTCATGGCAGGCT
TTGGCCAGTGAACAAATCCTACTCTGAAGCTAGACATGTGCTTTGAAATGATTATCATCCTAATATCAT
GGGGGAAAAAATACCAAATTTAAATTATATGTTTTGTGTTCTCATTTATTATCATTTTTTTCTGTACAA
ATCTATTATTTCTAGATTTTTGTATAACATGATAGACATAAAATTGGTTTATCTCCTCCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001212.4
Summary The human complement subcomponent C1q associates with C1r and C1s in order to yield the first component of the serum complement system. The protein encoded by this gene is known to bind to the globular heads of C1q molecules and inhibit C1 activation. This protein has also been identified as the p32 subunit of pre-mRNA splicing factor SF2, as well as a hyaluronic acid-binding protein. [provided by RefSeq, Jul 2008]
Locus ID 708
MW 10.2

Documents

Product Manuals
FAQs
  • 3' UTR Clones
SDS