Human Fatty Acid Binding Protein 5 (FABP5) activation kit by CRISPRa
Referencia GA101514
embalaje : 1kit
Human Fatty Acid Binding Protein 5 (FABP5) activation kit by CRISPRa
SKU
GA101514
FABP5 CRISPRa kit - CRISPR gene activation of human fatty acid binding protein 5
2 Weeks*
Product Data | |
Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
---|---|
Target Symbol | FABP5 |
Locus ID | 2171 |
Components | GA101514G1, Fatty Acid Binding Protein 5 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTTGTCAAACGGAGGGGTGC GA101514G2, Fatty Acid Binding Protein 5 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTTGTCAAACGGAGGGGTGC GA101514G3, Fatty Acid Binding Protein 5 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTATGCGGCCAATGGGAGG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc. |
Reference Data | |
RefSeq | NM_001444 |
UniProt ID | Q01469 |
Synonyms | E-FABP; EFABP; KFABP; PA-FABP; PAFABP |
Summary | This gene encodes the fatty acid binding protein found in epidermal cells, and was first identified as being upregulated in psoriasis tissue. Fatty acid binding proteins are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. FABPs may play roles in fatty acid uptake, transport, and metabolism. Polymorphisms in this gene are associated with type 2 diabetes. The human genome contains many pseudogenes similar to this locus.[provided by RefSeq, Feb 2011] |
Write Your Own Review
Product Manuals |
FAQs |
|
SDS |
SKU | Description | Size | ||
---|---|---|---|---|
KN401973 | FABP5 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. | 1 kit | | |
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.