Placental lactogen (CSH2) (NM_022644) Human 3' UTR Clone

CAT#: SC206972

3' UTR clone of chorionic somatomammotropin hormone 2 (CSH2) transcript variant 2 for miRNA target validation


Product Images

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CSH2
Synonyms CS-2; CSB; GHB1; hCS-B; PL
ACCN NM_022644
Insert Size 547 bp
Sequence Data
>SC206972 3’UTR clone of NM_022644
The sequence shown below is from the reference sequence of NM_022644. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTCGCCAATCCTGGAACCCCACTGGCTTAGAGGGCTGGGGGAGAGAAACACTGCTGCCCTCTTTGTAGC
AGTCAGGCGCTGACCCAAGAGAACTCACCTTATTCTTCATTTCGCCTGGTGAATCCTCCAGGCCCTTCT
CTACACCCTGAAGGGGAGGGAGGAAAATGGATGAATGAGAGAGGGAGGGAACAGTGCCCAAGCGCTTGG
CCTCTCCTTCTCTTCCTTCACTTTGCAGAGGCTGGAAGACGGCAGCCGCCGGACTGGGCAGATCCTCAA
GCAGACCTACAGCAAGTTTGACACAAACTCACACAACCATGACGCACTGCTCAAGAACTACGGGCTGCT
CTACTGCTTCAGGAAGGACATGGACAAGGTCGAGACATTCCTGCGCATGGTGCAGTGCCGCTCTGTAGA
GGGTAGCTGTGGCTTCTAGGTGCCCGCGTGGCATCCTGTGACCGACCCCTCCCCAGTGCCTCTCCTGGC
CCTGGAAGGTGCCACTCCAGTGCCCATCAGCCTTGTCCTAATAAAATTAAGTTGTATCATTTCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_022644.3
Summary The protein encoded by this gene is a member of the somatotropin/prolactin family of hormones and plays an important role in growth control. The gene is located at the growth hormone locus on chromosome 17 along with four other related genes in the same transcriptional orientation; an arrangement which is thought to have evolved by a series of gene duplications. Although the five genes share a remarkably high degree of sequence identity, they are expressed selectively in different tissues. Alternative splicing generates additional isoforms of each of the five growth hormones. This particular family member is expressed mainly in the placenta and utilizes multiple transcription initiation sites. Expression of the identical mature proteins for chorionic somatomammotropin hormones 1 and 2 is upregulated during development, while the ratio of 1 to 2 increases by term. Structural and expression differences provide avenues for developmental regulation and tissue specificity. [provided by RefSeq, Jul 2008]
Locus ID 1443
MW 19.8

Documents