Aconitase 2 (ACO2) (NM_001098) Human 3' UTR Clone

CAT#: SC205095

3' UTR clone of aconitase 2 mitochondrial (ACO2) nuclear gene encoding mitochondrial protein for miRNA target validation


Product Images

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ACO2
Synonyms ACONM; HEL-S-284; ICRD; OCA8; OPA9
ACCN NM_001098
Insert Size 391 bp
Sequence Data
>SC205095 3’UTR clone of NM_001098
The sequence shown below is from the reference sequence of NM_001098. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTCAACAGAATGAAGGAACTGCAACAGTGAGGGCAGTGCCTCCCCGCCCCGCCGCTGGCGTCAAGTTCA
GCTCCACGTGTGCCATCAGTGGATCCGATCCGTCCAGCCATGGCTTCCTATTCCAAGATGGTGTGACCA
GACATGCTTCCTGCTCCCCGCTTAGCCCACGGAGTGACTGTGGTTGTGGTGGGGGGGTTCTTAAAATAA
CTTTTTAGCCCCCGTCTTCCTATTTTGAGTTTGGTTCAGATCTTAAGCAGCTCCATGCAACTGTATTTA
TTTTTGATGACAAGACTCCCATCTAAAGTTTTTCTCCTGCCTGATCATTTCATTGGTGGCTGAAGGATT
CTAGAGAACCTTTTGTTCTTGCAAGGAAAACAAGAATCCAAAACCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001098.3
Summary The protein encoded by this gene belongs to the aconitase/IPM isomerase family. It is an enzyme that catalyzes the interconversion of citrate to isocitrate via cis-aconitate in the second step of the TCA cycle. This protein is encoded in the nucleus and functions in the mitochondrion. It was found to be one of the mitochondrial matrix proteins that are preferentially degraded by the serine protease 15(PRSS15), also known as Lon protease, after oxidative modification. [provided by RefSeq, Jul 2008]
Locus ID 50
MW 14.3

Documents