Specifications

Product Data
Gene ID	7132
Forward Sequence	CCGCTTCAGAAAACCACCTCAG
Reverse Sequence	ATGCCGGTACTGGTTCTTCCTG
Accession No	NM_001065, NM_001065.1, NM_001065.2, NM_001065.3, BC010140, BC010140.2, BF528949, NM_001065.4
UniProt ID	P19438
Synonyms	CD120a; FPF; p55; p55-R; p60; TBP1; TNF-R; TNF-R-I; TNF-R55; TNFAR; TNFR1; TNFR55; TNFR60
Component	1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
Quality Control	The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage	Store at -20°C.
Stability	The primer mix is stable for one year from date of shipping.