Biorbyt

Products for advancing your discoveries

 
From antibodies to proteins, biochemicals to ELISA kits, Biorbyt's high quality research products are available for you to enable world class research and contribution to a deeper understanding of life sciences.
 
A comprehensive catalog of life science research products covering the areas of Neuroscience, Signal transduction, Cell Biology, Cancer Metabolism, Cardiovascular and others
 
Product range :
 
  • Antibodies
Choose from over 100,000 primary antibodies and over 2,000 secondary antibodies. Monoclonals and polyclonals tested in a number of applications - WB, ELISA, IHC, FACS and many more.
 
  • Proteins
Choose from over 7,000 proteins and over 400 active proteins. All of our proteins have been validated for use in ELISAs, WB and IHC-P
 
  • Biochemicals
We have over 10,000 biochemicals for use in your research.
 
  • ELISA kits
We have over 2,000 ELISA kits covering many research areas . Each kit comes with a fully detailed protocol and examples of expected results.
 
 
 
Adapters for the preparation of DNA libraries for Illumina NGS

Adapters for the preparation of DNA libraries for Illumina NGS

Sequencing random fragments of DNA is possible via the addition of short nucleotide sequences which allow any DNA fragment to:
1. Bind to a flow cell for next generation sequencing
2. Allow for PCR enrichment of adapter ligated DNA fragments only
3. Allow for indexing or 'barcoding' of samples so multiple DNA libraries can be mixed together into 1 sequencing lane (known as multiplexing)

During library preparation each DNA fragment gets and addional A overhang added to both ends.

The sequencing adapters are the following:
# TruSeq Universal Adapter:
5 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T 3
# TruSeq Indexed Adapter
5 P*GATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG 3

The stars indicate a phosphorothioate bond between the last C and T to prevent cleaving off the last T that is needed for annealing the overhang. The phosphate group on the indexed adapter is required to ligate the adapter to the DNA fragment.
The NNNNNN in the indexed adapter above represents the barcode. Reverse the indexed adapter and note how the last 12 bases are complementary.

Diagram of an adapter




P5 and P7 : Flow cell attachment sites
ID : Index
Adapter : Sequencing primer binding sites
DNA fragment : Insert

Risultati della ricerca : 12 prodotto(i) trovato(i)

Limita la ricerca :

RUOCE / IVD
  • vahts dual umi udi adapters set 1 – 4
  • vahts maxi unique dual index dna adapters 4
  • vahts rna adapters set 1 - 4
  • kit 12
APPLICARE I FILTRI
REINIZIALIZZARE