Biorbyt
![]() |
||
Products for advancing your discoveries From antibodies to proteins, biochemicals to ELISA kits, Biorbyt's high quality research products are available for you to enable world class research and contribution to a deeper understanding of life sciences.
A comprehensive catalog of life science research products covering the areas of Neuroscience, Signal transduction, Cell Biology, Cancer Metabolism, Cardiovascular and others
Product range :
Choose from over 100,000 primary antibodies and over 2,000 secondary antibodies. Monoclonals and polyclonals tested in a number of applications - WB, ELISA, IHC, FACS and many more.
Choose from over 7,000 proteins and over 400 active proteins. All of our proteins have been validated for use in ELISAs, WB and IHC-P
We have over 10,000 biochemicals for use in your research.
We have over 2,000 ELISA kits covering many research areas . Each kit comes with a fully detailed protocol and examples of expected results.
Website : https://www.biorbyt.com/
|
![Adapters for the preparation of ARN (cDNA) libraries for Illumina NGS](https://www.clinisciences.com/nl/upload/adn2-bzw63x.jpg)
Adapters for the preparation of ARN (cDNA) libraries for Illumina NGS
Sequencing random fragments of DNA is possible via the
addition of short nucleotide sequences which allow any DNA fragment to:
1. Bind to a flow cell
for next generation sequencing
2. Allow for PCR
enrichment of adapter ligated DNA fragments only
3. Allow for indexing
or 'barcoding' of samples so multiple DNA libraries can be mixed
together into 1 sequencing lane (known as multiplexing)
During library preparation each DNA fragment gets and
addional A overhang added to both ends.
The sequencing adapters are the following:
# TruSeq
Universal Adapter:
5
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T 3
# TruSeq
Indexed Adapter
5 P*GATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG
3
The stars indicate a phosphorothioate bond between the last
C and T to prevent cleaving off the last T that is needed for annealing
the overhang. The phosphate group on the indexed adapter is required to
ligate the adapter to the DNA fragment.
The NNNNNN in the indexed adapter above represents the
barcode. Reverse the indexed adapter and note how the last 12 bases are
complementary.
Diagram of an adapter
![](/upload/illuminaadapters-wkstxu-WC5ZGHDg.jpg)
P5 and P7 : Flow cell attachment sites
ID : Index
Adapter : Sequencing primer binding sites
DNA fragment : Insert
Resultaat van uw zoeken : 4 product gevonden
Verfijn uw zoekopdracht :
RUOCE / IVD
- kit 4
Referentie
Beschrijving
Cond.
Price Bef. VAT
‹
›