Adapters for the preparation of DNA libraries for Illumina NGS
Sequencing random fragments of DNA is possible via the
addition of short nucleotide sequences which allow any DNA fragment to:
1. Bind to a flow cell
for next generation sequencing
2. Allow for PCR
enrichment of adapter ligated DNA fragments only
3. Allow for indexing
or 'barcoding' of samples so multiple DNA libraries can be mixed
together into 1 sequencing lane (known as multiplexing)
During library preparation each DNA fragment gets and
addional A overhang added to both ends.
The sequencing adapters are the following:
# TruSeq
Universal Adapter:
5
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T 3
# TruSeq
Indexed Adapter
5 P*GATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG
3
The stars indicate a phosphorothioate bond between the last
C and T to prevent cleaving off the last T that is needed for annealing
the overhang. The phosphate group on the indexed adapter is required to
ligate the adapter to the DNA fragment.
The NNNNNN in the indexed adapter above represents the
barcode. Reverse the indexed adapter and note how the last 12 bases are
complementary.
Diagram of an adapter
P5 and P7 : Flow cell attachment sites
ID : Index
Adapter : Sequencing primer binding sites
DNA fragment : Insert
Resultado da sua pesquisa : 37 produto encontrado
Refine sua procura :
RUOCE / IVD
- vahts dual umi udi adapters set 1 – 4
- vahts maxi unique dual index dna adapters 4
- vahts rna adapters set 1 - 4
- kit 24
- Other products 8
- pcr products 5
- PCR 13
Referência
Descrição
Cond.
Price Bef. VAT
‹
›